lamm-mit/sequence

Sequence Analysis

Analyze biological sequences using Biopython. Translate DNA, compute statistics, parse sequence files, and perform basic alignments.

Overview

This skill provides sequence analysis capabilities including:

• DNA/RNA translation to protein
• Sequence statistics (GC content, molecular weight, etc.)
• Reverse complement
• FASTA/GenBank file parsing
• Sequence alignment
• Motif searching

Usage

Translate DNA to protein:

python3 {baseDir}/scripts/sequence_tools.py translate --sequence "ATGCGATCGATCGATCG"

Compute sequence statistics:

python3 {baseDir}/scripts/sequence_tools.py stats --sequence "ATGCGATCGATCGATCG"

Get reverse complement:

python3 {baseDir}/scripts/sequence_tools.py revcomp --sequence "ATGCGATCGATCG"

Parse FASTA file:

python3 {baseDir}/scripts/sequence_tools.py parse --file sequences.fasta --format fasta

Find ORFs:

python3 {baseDir}/scripts/sequence_tools.py orfs --sequence "ATGCGATCGATCGATCGTAG"

Search for motif:

python3 {baseDir}/scripts/sequence_tools.py motif --sequence "ATGCGATCGATCG" --pattern "GATC"

Commands

translate

Translate DNA/RNA sequence to protein.

| Parameter | Description | Default | |-----------|-------------|---------| | --sequence | DNA/RNA sequence or file | Required | | --table | Codon table (1=standard, 2=mitochondrial, etc.) | 1 | | --frame | Reading frame (1, 2, 3, -1, -2, -3) | 1 | | --all-frames | Translate all 6 reading frames | False | | --to-stop | Translate until first stop codon | False |

stats

Compute sequence statistics.

| Parameter | Description | Default | |-----------|-------------|---------| | --sequence | Sequence or file | Required | | --type | Sequence type: dna, rna, protein, auto | auto |

Output includes:

• Length
• GC content (nucleotide)
• Molecular weight
• Base/amino acid composition

revcomp

Get reverse complement of DNA sequence.

| Parameter | Description | |-----------|-------------| | --sequence | DNA sequence or file |

parse

Parse sequence files (FASTA, GenBank, etc.).

| Parameter | Description | Default | |-----------|-------------|---------| | --file | Input file path | Required | | --format | File format: fasta, genbank, embl | auto | | --output | Output format: summary, fasta, json | summary |

orfs

Find Open Reading Frames.

| Parameter | Description | Default | |-----------|-------------|---------| | --sequence | DNA sequence or file | Required | | --min-length | Minimum ORF length (codons) | 30 | | --table | Codon table | 1 |

motif

Search for sequence motifs/patterns.

| Parameter | Description | Default | |-----------|-------------|---------| | --sequence | Sequence to search | Required | | --pattern | Pattern to find (supports IUPAC codes) | Required |

Examples

Translate with specific codon table:

python3 {baseDir}/scripts/sequence_tools.py translate --sequence "ATGCGATCG" --table 2

Get stats for protein sequence:

python3 {baseDir}/scripts/sequence_tools.py stats --sequence "MTEYKLVVVGAGGVGKSALTIQLIQ" --type protein

Parse GenBank file and extract sequences:

python3 {baseDir}/scripts/sequence_tools.py parse --file gene.gb --format genbank --output fasta

Find all ORFs with minimum 50 codons:

python3 {baseDir}/scripts/sequence_tools.py orfs --file genome.fasta --min-length 50

Translate all 6 reading frames:

python3 {baseDir}/scripts/sequence_tools.py translate --sequence "ATGCGATCGATCGATCG" --all-frames

Codon Tables

| ID | Description | |----|-------------| | 1 | Standard | | 2 | Vertebrate Mitochondrial | | 3 | Yeast Mitochondrial | | 4 | Mold/Protozoan Mitochondrial | | 5 | Invertebrate Mitochondrial | | 6 | Ciliate Nuclear | | 11 | Bacterial/Archaeal/Plant Plastid |

IUPAC Codes

Nucleotides

• R = A or G (purine)
• Y = C or T (pyrimidine)
• S = G or C
• W = A or T
• K = G or T
• M = A or C
• N = any nucleotide

Amino Acids

• X = any amino acid
• B = D or N
• Z = E or Q

Notes

• Sequences can be provided directly or as file paths
• Auto-detection identifies DNA/RNA/protein sequences
• Large files are processed efficiently with streaming