skills/molecular-biology/plannotate-plasmid-annotation/SKILL.md
Auto-annotate plasmids with features (promoters, terminators, resistance, origins, tags, fluorescent proteins) via BLAST against curated DBs (Addgene, fpbase, SnapGene). FASTA or raw sequence in; annotated GenBank, interactive HTML maps, CSV tables out. Handles circular topology. Use to verify synthetic constructs, prep Addgene submissions, share maps, or batch-annotate cloning libraries.
npx skillsauth add jaechang-hits/scicraft plannotate-plasmid-annotationInstall this skill globally with one command. Works with Claude Code, Cursor, and Windsurf.
3 of 9 scanners reported clean
Some scanners were skipped, did not run, or reported a non-clean status. Review each row below.
pLannotate annotates plasmid sequences by running BLAST searches against a curated library of over 5,000 features sourced from Addgene, NCBI, and fpbase. It identifies promoters, terminators, antibiotic resistance genes, origins of replication, tags, and fluorescent proteins while correctly handling circular plasmid topology — avoiding split-feature artifacts that arise from naive linear alignment. Results are written as annotated GenBank files for downstream use in SnapGene, Benchling, or BioPython, as interactive HTML plasmid maps for sharing and review, and as CSV tables for programmatic filtering. Both a Python API and a command-line interface are provided; a Streamlit web app is also bundled for exploratory use.
plannotate, biopython (optional, for GenBank parsing)# Install via pip (requires BLAST+ on PATH)
pip install plannotate
# Install via conda (recommended — handles BLAST+ automatically)
conda install -c conda-forge -c bioconda plannotate
# Verify installation
plannotate --help
python -c "import plannotate; print('plannotate OK')"
from plannotate import annotate, write_genbank, create_bokeh_chart
from Bio import SeqIO
# Load plasmid from FASTA
record = next(SeqIO.parse("plasmid.fasta", "fasta"))
sequence = str(record.seq)
# Annotate (circular, against Addgene database)
results = annotate(sequence, linear=False, db="addgene")
print(f"Found {len(results)} features")
print(results[["Feature", "Feature_type", "pct_identity", "pct_query_cov"]].to_string())
# Export GenBank file
write_genbank(sequence, results, output_file="plasmid_annotated.gb")
# Generate interactive HTML map
create_bokeh_chart(sequence, results, output_file="plasmid_map.html")
print("Outputs: plasmid_annotated.gb, plasmid_map.html")
Load the plasmid sequence from a FASTA file, a GenBank file (stripping existing annotations for re-annotation), or a raw sequence string. Validate length and base composition before annotation.
from Bio import SeqIO
import os
# Option A: Load from FASTA
def load_fasta(path):
record = next(SeqIO.parse(path, "fasta"))
seq = str(record.seq).upper()
return seq, record.id
# Option B: Load from GenBank (strip annotations, keep sequence)
def load_genbank(path):
record = next(SeqIO.parse(path, "genbank"))
seq = str(record.seq).upper()
return seq, record.id
# Option C: Raw sequence string
raw_seq = "ATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTT"
# Validate sequence
def validate_plasmid(seq, name="plasmid"):
valid_bases = set("ATGCNRYSWKMBDHV")
invalid = set(seq.upper()) - valid_bases
if invalid:
raise ValueError(f"Invalid bases in {name}: {invalid}")
if len(seq) < 100:
raise ValueError(f"Sequence too short ({len(seq)} bp); minimum 100 bp")
gc = (seq.count("G") + seq.count("C")) / len(seq) * 100
print(f"{name}: {len(seq):,} bp, GC={gc:.1f}%")
return seq
seq, plasmid_id = load_fasta("plasmid.fasta")
validate_plasmid(seq, plasmid_id)
Run annotation using the selected database. The linear flag controls whether the sequence is treated as circular (default for plasmids) or linear (for gene blocks and linear fragments).
from plannotate import annotate
# Annotate circular plasmid against the Addgene database (most comprehensive for common vectors)
results = annotate(
seq,
linear=False, # False = circular plasmid (default)
db="addgene", # Database: "addgene", "fpbase", or "snapgene"
)
print(f"Total features detected: {len(results)}")
print(f"\nColumns: {list(results.columns)}")
# Preview feature table
cols = ["Feature", "Feature_type", "start", "end", "strand", "pct_identity", "pct_query_cov"]
print(results[cols].sort_values("start").to_string(index=False))
Review annotation confidence using BLAST identity and query coverage scores. High-confidence annotations have >95% identity and >90% coverage; partial hits may indicate truncated or mutated features.
import pandas as pd
# Inspect hit quality distribution
print("Identity percentile summary:")
print(results["pct_identity"].describe().round(1))
print("\nCoverage percentile summary:")
print(results["pct_query_cov"].describe().round(1))
# Separate high- and low-confidence hits
high_conf = results[
(results["pct_identity"] >= 95) &
(results["pct_query_cov"] >= 90)
].copy()
low_conf = results[
(results["pct_identity"] < 95) |
(results["pct_query_cov"] < 90)
].copy()
print(f"\nHigh-confidence features (identity>=95%, coverage>=90%): {len(high_conf)}")
print(f"Low-confidence / partial features: {len(low_conf)}")
if not low_conf.empty:
print("\nLow-confidence features (review manually):")
print(low_conf[["Feature", "Feature_type", "pct_identity", "pct_query_cov"]].to_string(index=False))
# Save filtered table
results.to_csv("all_features.csv", index=False)
high_conf.to_csv("high_confidence_features.csv", index=False)
print("\nSaved: all_features.csv, high_confidence_features.csv")
Write the annotated sequence to GenBank format for import into plasmid editors (SnapGene, Benchling, Geneious, ApE) and for BioPython-based downstream analysis.
from plannotate import write_genbank
# Write full annotation (all features)
write_genbank(seq, results, output_file="plasmid_annotated.gb")
print("Written: plasmid_annotated.gb")
# Write with high-confidence features only
write_genbank(seq, high_conf, output_file="plasmid_highconf.gb")
print("Written: plasmid_highconf.gb")
# Verify using BioPython
from Bio import SeqIO
record = next(SeqIO.parse("plasmid_annotated.gb", "genbank"))
print(f"\nGenBank verification:")
print(f" Sequence length: {len(record.seq):,} bp")
print(f" Features: {len(record.features)}")
for feat in record.features:
label = feat.qualifiers.get("label", ["(unlabeled)"])[0]
print(f" [{feat.type:20s}] {label} @ {feat.location}")
Create a Bokeh-based interactive plasmid map. The HTML file is self-contained and can be shared without any server infrastructure.
from plannotate import create_bokeh_chart
# Generate interactive circular plasmid map
create_bokeh_chart(
seq,
results,
output_file="plasmid_map.html",
)
print("Interactive map saved: plasmid_map.html")
print("Open in any browser — no server required")
# Tip: open automatically in the default browser
import webbrowser, os
webbrowser.open(f"file://{os.path.abspath('plasmid_map.html')}")
Extract annotated features programmatically for downstream analysis — restriction site mapping, primer design, or construct verification reports.
from Bio import SeqIO
from Bio.SeqFeature import FeatureLocation
import pandas as pd
record = next(SeqIO.parse("plasmid_annotated.gb", "genbank"))
# Build a feature DataFrame from the GenBank record
rows = []
for feat in record.features:
label = feat.qualifiers.get("label", [""])[0]
note = feat.qualifiers.get("note", [""])[0]
rows.append({
"type": feat.type,
"label": label,
"note": note,
"start": int(feat.location.start),
"end": int(feat.location.end),
"strand": feat.location.strand,
"length": len(feat.location),
})
feat_df = pd.DataFrame(rows)
print(feat_df.to_string(index=False))
# Example: find antibiotic resistance genes
resistance = feat_df[feat_df["label"].str.contains(
r"AmpR|KanR|CmR|TetR|SpecR|HygR|ZeoR|BlastR|GentR",
case=False, na=False, regex=True
)]
print(f"\nAntibiotic resistance markers found: {len(resistance)}")
print(resistance[["label", "start", "end", "length"]].to_string(index=False))
Annotate an entire cloning library from a multi-FASTA file or a directory of individual FASTA files and aggregate results into a single summary table.
from plannotate import annotate, write_genbank, create_bokeh_chart
from Bio import SeqIO
import pandas as pd
import os
input_dir = "plasmids/" # directory of *.fasta files
output_dir = "annotated_results/"
os.makedirs(output_dir, exist_ok=True)
summary_rows = []
for fasta_file in sorted(f for f in os.listdir(input_dir) if f.endswith(".fasta")):
plasmid_name = fasta_file.replace(".fasta", "")
fasta_path = os.path.join(input_dir, fasta_file)
record = next(SeqIO.parse(fasta_path, "fasta"))
seq = str(record.seq).upper()
print(f"Annotating {plasmid_name} ({len(seq):,} bp)...", end=" ")
results = annotate(seq, linear=False, db="addgene")
print(f"{len(results)} features")
# Save per-plasmid outputs
write_genbank(
seq, results,
output_file=os.path.join(output_dir, f"{plasmid_name}.gb")
)
create_bokeh_chart(
seq, results,
output_file=os.path.join(output_dir, f"{plasmid_name}.html")
)
results.to_csv(os.path.join(output_dir, f"{plasmid_name}_features.csv"), index=False)
# Accumulate for summary
results["plasmid"] = plasmid_name
summary_rows.append(results)
# Consolidated summary table
summary = pd.concat(summary_rows, ignore_index=True)
summary.to_csv(os.path.join(output_dir, "all_plasmids_features.csv"), index=False)
print(f"\nBatch complete. {summary['plasmid'].nunique()} plasmids annotated.")
print(f"Summary table: {output_dir}all_plasmids_features.csv")
| Parameter | Default | Range / Options | Effect |
|-----------|---------|-----------------|--------|
| linear | False | True, False | Treat sequence as linear (True) or circular (False); circular mode handles split features at the origin correctly |
| db | "addgene" | "addgene", "fpbase", "snapgene" | Feature database to search; addgene is broadest (promoters, resistance genes, origins, tags); fpbase adds fluorescent protein variants; snapgene includes SnapGene-curated features |
| min_len | 0 | 0–500 bp | Minimum feature length in bp; increase to suppress short spurious matches |
| blast_identity_threshold | 95 | 70–100 % | Minimum BLAST % identity to report a hit; lower values detect diverged homologs but increase false positives |
| --html (CLI) | off | flag | Generate interactive HTML plasmid map alongside GenBank output |
| --csv (CLI) | off | flag | Write CSV feature table to the output directory |
| --linear (CLI) | off | flag | Treat input as linear sequence (default is circular) |
| --file / --input (CLI) | required | FASTA path | Input plasmid sequence in FASTA format |
When to use: exploring a single plasmid interactively without writing code, or sharing with wet-lab collaborators who prefer a browser interface.
# Launch the pLannotate Streamlit web app (opens in browser at localhost:5000)
plannotate streamlit
# Or specify a custom port
plannotate streamlit --port 8501
When to use: annotating multiple plasmids in a scripted workflow or on a remote server without Python scripting.
# Single plasmid
plannotate batch \
--input plasmid.fasta \
--output results/ \
--html \
--csv
# Multiple plasmids via shell glob
for f in plasmids/*.fasta; do
name=$(basename "$f" .fasta)
plannotate batch \
--input "$f" \
--output "annotated/${name}/" \
--html --csv
done
echo "Done. Outputs in annotated/"
When to use: verifying that a site-directed mutagenesis or insertion did not disrupt existing features or introduce unintended ones.
from plannotate import annotate
from Bio import SeqIO
import pandas as pd
def annotation_diff(seq_before, seq_after, db="addgene"):
res_before = annotate(seq_before, linear=False, db=db)
res_after = annotate(seq_after, linear=False, db=db)
features_before = set(res_before["Feature"])
features_after = set(res_after["Feature"])
gained = features_after - features_before
lost = features_before - features_after
shared = features_before & features_after
print(f"Shared features: {len(shared)}")
print(f"Gained features: {gained if gained else 'none'}")
print(f"Lost features: {lost if lost else 'none'}")
return res_before, res_after
seq_wt = str(next(SeqIO.parse("plasmid_wt.fasta", "fasta")).seq)
seq_mut = str(next(SeqIO.parse("plasmid_mut.fasta", "fasta")).seq)
res_before, res_after = annotation_diff(seq_wt, seq_mut)
When to use: sharing annotation results with collaborators who prefer spreadsheets over GenBank files.
from plannotate import annotate
from Bio import SeqIO
import pandas as pd
seq = str(next(SeqIO.parse("plasmid.fasta", "fasta")).seq)
results = annotate(seq, linear=False, db="addgene")
# Tidy column selection and renaming
export = results[[
"Feature", "Feature_type", "start", "end", "strand",
"pct_identity", "pct_query_cov", "database"
]].copy()
export.columns = [
"Feature Name", "Type", "Start (bp)", "End (bp)", "Strand",
"Identity (%)", "Coverage (%)", "Database"
]
export["Length (bp)"] = export["End (bp)"] - export["Start (bp)"]
export = export.sort_values("Start (bp)")
# Write to Excel with conditional formatting
with pd.ExcelWriter("plasmid_features.xlsx", engine="openpyxl") as writer:
export.to_excel(writer, sheet_name="Features", index=False)
print(f"Exported {len(export)} features to plasmid_features.xlsx")
| Output File | Format | Description |
|-------------|--------|-------------|
| plasmid_annotated.gb | GenBank | Sequence with annotated features; importable into SnapGene, Benchling, Geneious, ApE, BioPython |
| plasmid_map.html | HTML | Self-contained interactive circular plasmid map (Bokeh); shareable without a server |
| all_features.csv | CSV | Tabular feature list with columns: Feature, Feature_type, start, end, strand, pct_identity, pct_query_cov, database |
| high_confidence_features.csv | CSV | Filtered subset with identity >= 95% and coverage >= 90% |
| all_plasmids_features.csv | CSV | Batch mode: aggregated features across all plasmids with a plasmid column |
| Problem | Cause | Solution |
|---------|-------|----------|
| FileNotFoundError: blastn not found | BLAST+ not on PATH | Install via conda: conda install -c bioconda blast; or via package manager: brew install blast (macOS) / apt install ncbi-blast+ (Linux) |
| No features detected | Sequence is too short, wrong database, or non-standard bases | Verify sequence length >= 500 bp; try a different db (e.g., "fpbase" for fluorescent protein vectors); check for ambiguous bases with validate_plasmid() |
| Annotations wrap incorrectly at position 0 | Sequence treated as linear when it is circular | Set linear=False (default); this enables circular BLAST to catch features that span the sequence origin |
| HTML map renders blank | bokeh version mismatch | Upgrade: pip install --upgrade bokeh; pLannotate requires Bokeh >=2.4 |
| Low identity hits for known features | Feature sequence has been mutated or codon-optimized | Lower blast_identity_threshold to 85–90%; add a note that these are diverged homologs |
| MemoryError or very slow annotation | Sequence > 50 kb or BLAST database not indexed | Split large sequences into sub-regions; ensure the internal pLannotate database index exists (reinstall if needed) |
| GenBank file not parsed by SnapGene | Non-standard feature type labels | Open in Geneious or BioPython first; check for special characters in feature qualifiers |
tools
Fast short-read DNA aligner for WGS/WES/ChIP-seq. 2× faster BWA-MEM successor; outputs SAM/BAM with read group headers for GATK. Primary plus supplementary records for chimeric reads. Use STAR for RNA-seq splice-aware alignment; Bowtie2 is a comparable alternative.
tools
smina molecular docking CLI. AutoDock Vina fork with customizable scoring functions, native SDF/MOL2/PDB ligand input, autoboxing, local energy minimization, and per-atom score breakdowns. Pipeline: receptor PDBQT prep -> ligand prep (RDKit/OpenBabel) -> dock via autobox or explicit grid -> rescore/minimize with custom scoring -> rank poses by affinity. Choose smina over Vina when you need custom scoring terms (--custom_scoring), local optimization of an existing pose (--local_only), per-atom contributions (--atom_term_data), or SDF/MOL2 ligands without manual PDBQT conversion. For unknown binding sites use diffdock-blind-docking; for the Python-bindings/Vinardo workflow use autodock-vina-docking.
development
mdtraj molecular dynamics trajectory analysis (Python). Reads DCD/XTC/TRR/NetCDF/H5/PDB topologies and trajectories; computes RMSD vs time, radius of gyration, per-residue RMSF, residue-residue contact frequency maps, phi/psi torsions for Ramachandran plots (general + Gly/Pro), and 8-state DSSP secondary structure. Modules: trajectory I/O, geometry (distances/angles/dihedrals), structural analysis (RMSD/Rg/RMSF/SASA), contacts, hydrogen bonds, secondary structure (DSSP), NMR observables. For broader atom-selection grammar use mdanalysis-trajectory; for running MD simulations use OpenMM/GROMACS.
development
Programmatic PubMed access via NCBI E-utilities REST API. Covers Boolean/MeSH queries, field-tagged search, endpoints (ESearch, EFetch, ESummary, EPost, ELink), history server for batches, citation matching, systematic review strategies. Use for biomedical literature search or automated pipelines.