scientific-skills/Data Analysis/crispr-grna-designer/SKILL.md
Design CRISPR gRNA sequences for specific gene exons with off-target prediction and efficiency scoring. Trigger when user needs gRNA design, CRISPR guide RNA selection, or genome editing target analysis.
npx skillsauth add aipoch/medical-research-skills crispr-grna-designerInstall this skill globally with one command. Works with Claude Code, Cursor, and Windsurf.
4 of 9 scanners reported clean
Some scanners were skipped, did not run, or reported a non-clean status. Review each row below.
Design optimal guide RNA (gRNA) sequences for CRISPR-Cas9 genome editing. Supports on-target efficiency scoring and off-target prediction.
| Parameter | Type | Required | Description |
|-----------|------|----------|-------------|
| gene_symbol | string | Yes | HGNC gene symbol (e.g., TP53, BRCA1) |
| target_exon | int | No | Specific exon number (default: all coding exons) |
| genome_build | string | No | Reference genome: hg38 (default), hg19, mm10 |
| pam_sequence | string | No | PAM motif: NGG (default), NAG, NGCG |
| guide_length | int | No | gRNA length in bp (default: 20) |
| gc_content_min | float | No | Minimum GC% (default: 30) |
| gc_content_max | float | No | Maximum GC% (default: 70) |
| poly_t_threshold | int | No | Max consecutive T's (default: 4) |
| off_target_check | bool | No | Enable off-target prediction (default: true) |
| max_mismatches | int | No | Max mismatches for off-target (default: 3) |
{
"gene": "TP53",
"genome": "hg38",
"guides": [
{
"id": "TP53_E2_G1",
"exon": 2,
"sequence": "GAGCGCTGCTCAGATAGCGATGG",
"pam": "NGG",
"position": "chr17:7669609-7669631",
"strand": "+",
"gc_content": 52.2,
"efficiency_score": 0.78,
"off_target_count": 2,
"off_targets": [...],
"warnings": []
}
]
}
Combines multiple position-specific features:
score = w1*position_score + w2*gc_score + w3*secondary_score + w4*poly_t_score
max_mismatchespython scripts/main.py --gene TP53 --exon 4 --output results.json
python scripts/main.py --gene BRCA1 --max-mismatches 2 --gc-min 35 --gc-max 65
python scripts/main.py --gene-list genes.txt --genome mm10 --pam NAG
⚠️ Difficulty: HIGH - Requires manual verification before experimental use
See references/ for:
scoring_algorithms.pdf - Deep learning models (DeepCRISPR, CRISPRon)off_target_databases/ - GUIDE-seq validated datasetsefficiency_benchmarks/ - Doench et al. 2014/2016 rulesCore script: scripts/main.py
Key functions:
fetch_gene_sequence() - Retrieve exon sequences from Ensemblfind_pam_sites() - Identify PAM-adjacent target sitesscore_efficiency() - Calculate on-target scorespredict_off_targets() - Bowtie2/BWA alignment for off-targetsrank_guides() - Multi-criteria optimizationOptional:
| Risk Indicator | Assessment | Level | |----------------|------------|-------| | Code Execution | Python scripts with bioinformatics tools | High | | Network Access | Ensembl API calls for gene sequences | High | | File System Access | Read/write genome data and results | Medium | | Instruction Tampering | Scientific computation guidelines | Low | | Data Exposure | Genome data handled securely | Medium |
# Python dependencies
pip install -r requirements.txt
# Optional tools
# bowtie2 (for local off-target alignment)
# ViennaRNA (for secondary structure prediction)
tools
Generates complete conventional oncology bulk-transcriptome biomarker and hub-gene research designs from a user-provided cancer type and study direction. Always use this skill whenever a user wants to design, plan, or build a tumor bioinformatics study centered on differential expression, prognostic filtering or risk modeling, PPI-based hub-gene prioritization, diagnostic/prognostic evaluation, clinical association, immune infiltration context, methylation context, and optional tissue or cell validation. Covers five study patterns (signature-first prognostic workflow, hub-gene-first biomarker workflow, hybrid signature-to-hub workflow, immune-context biomarker workflow, translational validation workflow) and always outputs four workload configs (Lite / Standard / Advanced / Publication+) with recommended primary plan, step-by-step workflow, figure plan, validation strategy, minimal executable version, publication upgrade path...
development
Generates complete conventional non-oncology bioinformatics research designs from a user-provided disease context, process-related gene family or biological theme, and validation direction. Use when a study centers on multi-dataset bulk transcriptome integration, DEG analysis, process-gene intersection, enrichment analysis, GSEA, PPI hub-gene prioritization, TF/miRNA regulatory networks, ROC-based biomarker evaluation, and immune infiltration analysis. Covers five study patterns (process-DEG discovery, enrichment/GSEA interpretation, hub-gene prioritization, regulatory-network and immune interpretation, multi-layer public validation) and always outputs Lite / Standard / Advanced / Publication+ with a recommended primary plan, stepwise workflow, figure plan, validation hierarchy, minimal executable version, publication upgrade path, and strictly verified literature retrieval.
tools
Plans confounder control, variable adjustment logic, and bias mitigation strategies at the protocol stage for clinical, epidemiologic, translational, observational, and biomarker studies. Always use this skill when a user needs to identify major confounders, decide which variables should or should not be adjusted for, compare matching/stratification/weighting approaches, anticipate selection or measurement bias, or pressure-test a study design before execution. Focus on bias sensing, causal structure awareness, variable-role classification, and critical design review rather than generic statistical advice.
testing
Generates complete comparative network-toxicology research designs from a user-provided exposure pair, shared toxic phenotype, and validation direction. Use when a study centers on two related exposures under one outcome and needs target collection, shared-vs-specific target decomposition, enrichment, PPI hub prioritization, docking, optional transcriptomic cross-checks, and conservative mechanistic synthesis. Covers five study patterns and always outputs Lite / Standard / Advanced / Publication+ with a recommended primary plan, stepwise workflow, figure plan, validation hierarchy, minimal executable version, publication upgrade path, and strictly verified literature retrieval.