read-qc/adapter-trimming/SKILL.md
Remove sequencing adapters from FASTQ files using Cutadapt and Trimmomatic. Supports single-end and paired-end reads, Illumina TruSeq, Nextera, and custom adapter sequences. Use when FastQC shows adapter contamination or before alignment of short reads.
npx skillsauth add GPTomics/bioSkills bio-read-qc-adapter-trimmingInstall this skill globally with one command. Works with Claude Code, Cursor, and Windsurf.
3 of 9 scanners reported clean
Some scanners were skipped, did not run, or reported a non-clean status. Review each row below.
Reference examples tested with: FastQC 0.12+, Trimmomatic 0.39+, cutadapt 4.4+, fastp 0.23+
Before using code patterns, verify installed versions match. If versions differ:
<tool> --version then <tool> --help to confirm flagsIf code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.
Remove sequencing adapters from reads using Cutadapt (precise, flexible) or Trimmomatic (paired-end optimized).
"Trim adapters from reads" -> Remove sequencing adapter sequences from FASTQ reads to prevent adapter contamination in downstream alignment.
cutadapt -a ADAPTER -o out.fq in.fq or trimmomatic PE with ILLUMINACLIPfastp -i in.fq -o out.fq (auto-detects adapters)| Platform/Kit | Adapter | Sequence | |--------------|---------|----------| | Illumina TruSeq | Read 1 3' | AGATCGGAAGAGCACACGTCTGAACTCCAGTCA | | Illumina TruSeq | Read 2 3' | AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT | | Nextera | Transposase | CTGTCTCTTATACACATCT | | Small RNA | 3' adapter | TGGAATTCTCGGGTGCCAAGG | | Poly-A | Poly-A tail | AAAAAAAAAAAAAAAA |
# 3' adapter (most common)
cutadapt -a AGATCGGAAGAGC -o trimmed.fastq.gz sample.fastq.gz
# 5' adapter
cutadapt -g ACGTACGT -o trimmed.fastq.gz sample.fastq.gz
# Both ends
cutadapt -a ADAPTER1 -g ADAPTER2 -o trimmed.fastq.gz sample.fastq.gz
# Multiple adapters (tries each)
cutadapt -a ADAPTER1 -a ADAPTER2 -a ADAPTER3 -o trimmed.fastq.gz sample.fastq.gz
# Basic paired-end
cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA \
-A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT \
-o trimmed_R1.fastq.gz -p trimmed_R2.fastq.gz \
sample_R1.fastq.gz sample_R2.fastq.gz
# Short form for Illumina TruSeq (auto-detect)
cutadapt -a AGATCGGAAGAGC -A AGATCGGAAGAGC \
-o trimmed_R1.fastq.gz -p trimmed_R2.fastq.gz \
sample_R1.fastq.gz sample_R2.fastq.gz
# Error rate (default 0.1 = 10% mismatches allowed)
cutadapt -a ADAPTER -e 0.15 -o out.fq in.fq
# Minimum overlap (default 3)
cutadapt -a ADAPTER -O 5 -o out.fq in.fq
# No indels in adapter alignment
cutadapt -a ADAPTER --no-indels -o out.fq in.fq
# Trim Ns from ends
cutadapt --trim-n -o out.fq in.fq
# Anchored adapters (must be at end)
cutadapt -a ADAPTER$ -o out.fq in.fq
# 5' adapter followed by 3' adapter (same read)
cutadapt -a ADAPTER1...ADAPTER2 -o out.fq in.fq
# Anchored 5' linked to 3'
cutadapt -a ^ADAPTER1...ADAPTER2 -o out.fq in.fq
# Minimum length (discard shorter)
cutadapt -a ADAPTER -m 20 -o out.fq in.fq
# Maximum length
cutadapt -a ADAPTER -M 150 -o out.fq in.fq
# Maximum N content
cutadapt -a ADAPTER --max-n 0.1 -o out.fq in.fq
# Discard trimmed reads
cutadapt -a ADAPTER --discard-trimmed -o out.fq in.fq
# Discard untrimmed reads
cutadapt -a ADAPTER --discard-untrimmed -o out.fq in.fq
# Both reads must pass minimum length
cutadapt -a ADAPT1 -A ADAPT2 -m 20 \
-o R1.fq -p R2.fq in_R1.fq in_R2.fq
# Output too-short reads separately
cutadapt -a ADAPT1 -A ADAPT2 -m 20 \
--too-short-output short_R1.fq --too-short-paired-output short_R2.fq \
-o R1.fq -p R2.fq in_R1.fq in_R2.fq
# Mask adapter instead of trim (replace with N)
cutadapt -a ADAPTER --action=mask -o out.fq in.fq
# Retain adapter but lowercase
cutadapt -a ADAPTER --action=lowercase -o out.fq in.fq
# Just find adapters, don't modify
cutadapt -a ADAPTER --action=none -o out.fq in.fq
trimmomatic SE -phred33 \
input.fastq.gz output.fastq.gz \
ILLUMINACLIP:adapters.fa:2:30:10
trimmomatic PE -phred33 -threads 4 \
input_R1.fastq.gz input_R2.fastq.gz \
output_R1_paired.fastq.gz output_R1_unpaired.fastq.gz \
output_R2_paired.fastq.gz output_R2_unpaired.fastq.gz \
ILLUMINACLIP:TruSeq3-PE-2.fa:2:30:10
ILLUMINACLIP:<fastaWithAdapters>:<seed>:<palindrome>:<simple>
# Parameters:
# seed - max mismatches in 16bp seed (usually 2)
# palindrome - threshold for palindrome match (usually 30)
# simple - threshold for simple match (usually 10)
# Example with all options
ILLUMINACLIP:adapters.fa:2:30:10:2:keepBothReads
Trimmomatic includes adapter files:
TruSeq2-SE.fa - TruSeq v2 single-endTruSeq2-PE.fa - TruSeq v2 paired-endTruSeq3-SE.fa - TruSeq v3 single-endTruSeq3-PE.fa - TruSeq v3 paired-endTruSeq3-PE-2.fa - TruSeq v3 PE (palindrome mode)NexteraPE-PE.fa - Nextera paired-end# Find adapter directory
TRIMMOMATIC_JAR=$(which trimmomatic | xargs dirname)/../share/trimmomatic-*/adapters/
# Or with conda
ls $CONDA_PREFIX/share/trimmomatic-*/adapters/
# Cutadapt with multiple cores
cutadapt -j 8 -a ADAPTER -o out.fq in.fq
# Trimmomatic threads
trimmomatic PE -threads 8 ...
# Check adapter removal with FastQC
fastqc trimmed.fastq.gz
# Count reads before/after
zcat input.fastq.gz | wc -l
zcat trimmed.fastq.gz | wc -l
testing
Analyze multi-modal single-cell data (CITE-seq, Multiome, spatial). Use when working with data that measures multiple modalities per cell like RNA + protein or RNA + ATAC. Use when analyzing CITE-seq, Multiome, or other multi-modal single-cell data.
data-ai
Analyze metabolite-mediated cell-cell communication using MeboCost for metabolic signaling inference between cell types. Predict metabolite secretion and sensing patterns from scRNA-seq data. Use when studying metabolic crosstalk between cell populations or metabolite-receptor interactions.
development
Find marker genes and annotate cell types in single-cell RNA-seq using Seurat (R) and Scanpy (Python). Use for differential expression between clusters, identifying cluster-specific markers, scoring gene sets, and assigning cell type labels. Use when finding marker genes and annotating clusters.
development
Reconstruct cell lineage trees from CRISPR barcode tracing or mitochondrial mutations. Use when studying clonal dynamics, cell fate decisions, or developmental trajectories.